Preview

Сахарный диабет

Расширенный поиск

Изучение ассоциаций полиморфных маркеров генов факторов некроза опухоли и их рецепторов rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 с формированием сахарного диабета 2 типа

https://doi.org/10.14341/2072-0351-5845

Полный текст:

Аннотация

Одной из наиболее продуктивных современных технологий геномных исследований сахарного диабета 2 типа (СД2) является анализ ассоциаций полиморфных маркеров генов-кандидатов с развитием заболевания.


Цель. Изучение ассоциации полиморфных генетических маркеров факторов некроза опухоли и их рецепторов (rs1800629 TNFα, rs909253 Ltα, rs767455 TNFR1, rs1061624 TNFR2) с формированием СД2 среди населения Центрального Черноземья РФ.


Материалы и методы. Проведен анализ результатов наблюдений 544 человек из русских жителей Центрального Черноземья России: 236 пациентов с установленным диагнозом СД2 (диагноз установлен на основании стандартных диагностических критериев) и 308 человек контрольной группы. Анализ всех локусов осуществлялся методом ПЦР синтеза ДНК, с использованием TaqMan зондов. Статистический анализ распределения частот генотипов проводили с использованием таблиц сопряженности и критерия χ2, р≤0,05.


Результаты. Анализ методом «случай-контроль» показал, что генотип GG rs909253Ltα является фактором риска развития СД2 (OR=2,36, р=0,01). Установлено, что индивидуумы с генотипом AA rs767455 TNFR1 отличаются ранним возрастом манифестации СД2 по сравнению с больными, имеющими генетические варианты AG и GG (р=0,01).


Заключение. В результате проведенного исследования впервые продемонстрирована вовлеченность полиморфных маркеров генов факторов некроза опухоли и их рецепторов в формирование СД2 у русских жителей Центрального Черноземья России.

Для цитирования:


Чурносов М.И., Белоусова О.Н., Сиротина С.С. Изучение ассоциаций полиморфных маркеров генов факторов некроза опухоли и их рецепторов rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 с формированием сахарного диабета 2 типа. Сахарный диабет. 2017;20(3):166-171. https://doi.org/10.14341/2072-0351-5845

For citation:


Churnosov M.I., Belousova O.N., Sirotina S.S. Study of the associations between polymorphic markers rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 and the development of type 2 diabetes. Diabetes mellitus. 2017;20(3):166-171. https://doi.org/10.14341/2072-0351-5845

Cахарный диабет 2 типа (СД2) – самое распространенное эндокринное заболевание, которое представляет собой одну из острейших медико-социальных проблем, так как ведет к ранней инвалидизации и повышению смертности среди населения вследствие развития различных осложнений [1]. В настоящее время более 415 млн человек в возрасте от 20 до 79 лет в мире страдают СД, в 90% случаев это СД2. В России более 4 млн человек больны СД, из них 3,7 млн – СД2 [2]. По частоте инвалидизации и смертности СД стоит на 3-м месте после сердечно-сосудистых заболеваний и онкопатологии. Между тем, результаты контрольно-эпидемиологических исследований, проведенных ФГБУ «Эндокринологический научный центр» (ЭНЦ) МЗ РФ в период с 2002 по 2010 гг., показали, что истинная численность больных СД в России приблизительно в 3–4 раза больше официально зарегистрированной и достигает 9–10 млн человек, что составляет около 7% населения [3].

СД2 относят к мультифакториальным заболеваниям. Согласно литературным данным, роль генетических факторов в развитии СД2 составляет 15–50% [4]. Научные исследования последних лет показали, что важное значение в развитии СД2 играют цитокины, которые способствуют развитию инсулинорезистентности, причем одними из ключевых медиаторов ее развития являются факторы некроза опухоли [5]. Обладая множеством медико-биологических эффектов (оказывают иммуномодулирующее, цитотоксическое и провоспалительное действие, стимулируют липолиз, активируют систему гемостаза, индуцируют апоптоз и др.), факторы некроза опухоли (фактор некроза опухоли-α (TNFα), лимфотоксин-α (Ltα)) могут влиять на развитие и прогрессирование СД2 [6].

Так, гиперпродукция TNFα приводит к снижению чувствительности к действию инсулина и, как следствие, изменению метаболизма глюкозы в жировой, мышечной тканях и печени. Также установлено, что при наличии ожирения и инсулинорезистентности TNFα, синтезируемый в жировой и мышечной ткани, обнаруживается в больших количествах и обладает возможностью проявлять пара- и аутокринные свойства [7]. Ltα является хемоаттрактантом для нейтрофилов, стимулирует в них образование пероксид-ионов, усиливает фагоцитоз и адгезию к эндотелию, стимулирует активность фибробластов, а также провоцирует выработку стресс-гормонов, влияет на метаболизм глюкозы [8]. Свои медико-биологические эффекты факторы некроза опухоли (TNFα, Ltα) реализуют через специфические рецепторы 1-го и 2-го типа (TNFR1 и TNFR2 соответственно). TNFR1 несет ответственность за острый воспалительный ответ и экспрессируется в большинстве типов клеток. TNFR2 участвует главным образом в реализации метаболических эффектов факторов некроза опухолей, а именно регулирует жировой и углеводный обмен. Таким образом, факторы некроза опухоли через свои рецепторы могут влиять на развитие и прогрессирование СД2.

С молекулярно-генетических позиций СД2 изучается достаточно активно как за рубежом, так и в Российской Федерации [9]. Однако результаты работ, посвященных изучению связей генов-кандидатов факторов некроза опухоли и их рецепторов с развитием СД2, неоднозначны в разных популяциях. Так, например, показано, что аллель А rs1800629TNFα является фактором риска формирования СД2 в иранской (OR=2,34) [10], индийской (OR=3,21) [11] и бразильской (OR=1,82) [12] популяциях. Среди населения Хорватии и Венгрии данных ассоциаций выявлено не было [13], а в популяции Мексики установлено, что фактором риска развития СД2 является генотип GGrs1800629 TNFα (OR=3,64) [14].

Роль полиморфных маркеров генов факторов некроза опухоли и их рецепторов в отношении СД2 в нашей стране изучена недостаточно, что диктует необходимость проведения данных исследований в различных популяциях Российской Федерации.

Цель

Целью настоящей работы было изучение ассоциации полиморфных маркеров факторов некроза опухоли и их рецепторов (rs1800629 TNFα, rs909253 Ltα, rs767455 TNFR1, rs1061624 TNFR2) с формированием СД2 среди населения Центрального Черноземья РФ.

Материалы и методы

Проведен анализ результатов наблюдений 544 человек: 236 пациентов с установленным диагнозом СД2 и 308 человек контрольной группы. В выборки больных СД2 и контроля включались индивидуумы русской национальности, являющиеся уроженцами Центрального Черноземья России и не имеющие родства между собой. Диагноз СД2 устанавливался после детального клинического, лабораторного обследования пациентов в отделении эндокринологии Белгородской областной клинической больницы Святителя Иоасафа на основании критериев Комитета экспертов ВОЗ (1999) и Федеральной целевой программы «Сахарный диабет» (2002). В группу контроля включались индивидуумы без наличия СД2. Все пациенты подписали информированное согласие на проведение исследования.

Исследуемые группы были сопоставимы по основным биологическим показателям: полу, возрасту и индексу массы тела (табл. 1).

Таблица 1. Медико-биологические и клинико-лабораторные характеристики исследуемых групп, х±SD

Показатель

Больные (N=236)

Контроль (N=308)

p

Пол (м/ж)

64/172

82/226

>0,05

Возраст, лет

57,85±6,11

60,20±6,28

>0,05

Возраст манифестации, лет

48,2±0,48

-

-

Длительность диабета, лет

9,7±0,37

-

-

Индекс массы тела, кг/м2

29,7±4,8

27,3±5,5

>0,05

Гликированный гемоглобин, %

8,77± 0,13

-

-

Уровень глюкозы натощак, ммоль/л

9,6±1,7

5,6±1,1

<0,05

Уровень глюкозы плазмы через 2 ч после приема пищи, ммоль/л

-

6,8±0,8

-

Базальный уровень инсулина, мкЕд/мл

14,8±9,1

10,2±4,9

<0,05

Уровень инсулина через 2 ч после приема пищи, мкЕд/л

-

46,5±21,7

-

Удельный вес пациентов с наследственной отягощенностью по СД2, n,%

103 (43,64)

-

-

Примечание: х – среднее, SD – стандартное квадратичное отклонение

Материалом для молекулярно-генетического исследования послужила венозная кровь в объеме 8–9 мл, взятая из локтевой вены пробанда. Выделение геномной ДНК из периферической крови проведено методом фенольно-хлороформной экстракции.

Анализ всех локусов (rs1800629 TNFα, rs909253 Ltα, rs767455 TNFR1, rs1061624 TNFR2) осуществлялся методом полимеразной цепной реакции (ПЦР) синтеза ДНК. ПЦР проводилась на амплификаторе IQ5 производства компании Bio-Rad с использованием ДНК-полимеразы Thermusaquaticus производства фирмы «Силекс-М», г. Москва и олигонуклеотидных праймеров и зондов, синтезированных фирмой «Синтол» г. Москва (табл. 2). Генотипирование осуществлялось методом дискриминации аллелей с использованием TaqMan зондов. Обозначения полиморфных маркеров даны в соответствии с базой данных dbSNP.

Таблица 2. Условия амплификации, последовательности праймеров и флуоресцентных зондов

Ген

Полиморфный маркер

Последовательность

праймеров и зондов, 5`-3`

Температура отжига, °С

TNFα

G/A

rs1800629

GAAATGGAGGCAATAGGTTTTGAG

GGCCACTGACTGATTTGTGTGTAG

FAM-CCGTCCTCATGCC- RTQ1

ROX-CCGTCCCCATGCC – RTQ1

52

Ltα

A/G

rs909253

CAGTCTCATTGTCTCTGTCACACATT

ACAGAGAGAGACAGGAAGGGAACAFAM:CCATGGTTCCTCTC-RTQ1

ROX:CTGCCATGATTCC-RTQ1

50

TNFR1

A/G

rs767455

AGCCCACTCTTCCCTTTGTC

CCACCGTGCCTGACCTG

FAM: CTGCTGCCACTGGT-RTQ1

ROX: CTGCTGCCGCTGGT-BHQ2

62

TNFR2

A/G

rs1061624

TGACCTGCAGGCCAAGAG

CCATGGCAGCAGAGGCTTT

FAM: CACAACCCGCTGCC – RTQ1

ROX: CCACAACTCGCTGCC – BHQ2

59

Формирование базы данных и статистические расчеты осуществлялись с использованием программы STATISTICA 6.0. Определение фенотипических и генных частот проводили стандартными методами. Для оценки соответствия наблюдаемого распределения ожидаемому, исходя из равновесия Харди-Вайнберга, использовали критерий χ2.

Статистический анализ распределения частот генотипов проводили с использованием таблиц сопряженности и критерия хи-квадрат (χ2) с поправкой Йетса на непрерывность и отношения шансов (OR) с 95% доверительным интервалом (CI). При сравнительном анализе качественных показателей, характеризующих больных СД2 и контрольную группу, использовали непараметрическую статистику (критерий Манна-Уитни) [15].

Этическая экспертиза

По результатам рассмотрения протокола исследования этическим комитетом Белгородского государственного университета решено «Разрешить проведение исследования «Клинико-генетическое исследование больных сахарным диабетом 2 типа»» (Белоусова О.Н., кафедра медико-биологических дисциплин), протокол №3 от 14.05.2009.

Результаты и обсуждение

Изучение частот генотипов изучаемых генетических маркеров показало, что для всех рассмотренных локусов в контрольной выборке и в группе больных СД2 эмпирическое распределение генотипов соответствует теоретически ожидаемому при равновесии Харди-Вайнберга (p>0,05), а наблюдаемая гетерозиготность (Н0) не отличается от ожидаемой гетерозиготности (НЕ) (р>0,05).

Анализ методом «случай-контроль» (больные СД2 – здоровые лица) показал наличие статистически значимой ассоциации полиморфного маркера rs909253Ltα с развитием СД2: генотип GG повышает риск развития СД2 (OR=2,36, р=0,01) (табл. 3).

Таблица 3. Распределение полиморфных маркеров генов факторов некроза опухоли и их рецепторов у больных СД2 и в контрольной группе

Локусы

Аллели, генотипы

Больные СД2 (n=236)

Контрольная группа (n=308)

ОR (95% СI)

χ2; p

n (%)

n (%)

rs909253 Ltα

A

341 (72,25)

473 (77,04)

0,77 (0,58–1,03)

χ2=3,01; p=0,08

G

131 (27,75)

141 (22,96)

1,29 (0,97–1,74)

χ2=3,01; p=0,08

AA

129 (54,66)

180 (58,63)

0,85 (0,59–1,81)

χ2=0,70; p=0,40

AG

83 (35,16)

113 (36,80)

0,93 (0,64–1,34)

χ2=0,09; p=0,76

GG

24 (10,18)

14 (4,57)

2,36 (1,14–4,95)

χ2=5,61; p=0,01

H0(HE), PHWE

0,35 (0,40), >0,05

0,36 (0,35), >0,05

   

rs1800629 TNFα

G

405 (85,81)

539 (88,94)

0,75 (0,91–1,94)

χ2=2,12; p=0,14

A

67 (14,19)

67 (11,06)

1,33 (0,51–1,09)

χ2=2,12; p=0,14

GG

176 (74,57)

242 (79,87)

0,73 (0,48–1,13)

χ2=1,84; p=0,17

AG

53 (22,45)

55 (18,15)

1,30 (0,83–2,05)

χ2=1,27; p=0,25

AA

7 (2,98)

6 (1,98)

1,51 (0,45–5,15)

χ2=0,20; p=0,64

H0(HE), PHWE

0,22 (0,24), >0,05

0,18 (0,19),>0,05

   

rs767455 TNFR1

G

237 (50,42)

318 (51,62)

0,94 (0,73–1,21)

χ2=0,16; p=0,68

A

235 (49,58)

298 (48,38)

1,05 (0,82–1,35)

χ2=0,16; p=0,68

GG

66 (27,96)

76 (24,68)

1,18 (0,79–1,77)

χ2=0,58; p=0,44

AG

106 (44,91)

166 (53,89)

0,69 (0,48–0,99)

χ2=3,95; p=0,04

AA

64 (27,13)

66 (21,43)

1,36 (0,90–2,06)

χ2=2,07; p=0,15

H0(HE), PHWE

0,44 (0,50) >0,05

0,53 (0,49) >0,05

   

rs1061624 TNFR2

G

272 (57,63)

341 (55,74)

1,07 (0,83–1,37)

χ2=0,25; p=0,61

A

200 (42,37)

269 (44,26)

0,93 (0,72–1,19)

χ2=0,25; p=0,61

GG

81 (34,32)

101 (33,12)

1,05 (0,72–1,53)

χ2=0,04; p=0,83

AG

110 (46,61)

138 (45,24)

1,05 (0,74–1,50)

χ2=0,05; p=0,81

AA

45 (19,07)

66 (21,64)

0,85 (0,54–1,33)

χ2=0,39; p=0,53

H0(HE), PHWE

0,46(0,48) >0,05

0,43(0,49), >0,05

   

Примечание: H0 и HE – наблюдаемая и ожидаемая гетерозиготность

Следует отметить, что полученные нами данные соответствуют литературным материалам о биологическом значении Ltα в организме. Так, согласно работе Brian E. C. (2009), он обладает выраженным провоспалительным, цитотоксическим, иммуномодулирующим действиями, и именно эти механизмы его действия имеют одно из важных значений в этиопатогенезе СД2 [16]. При этом следует подчеркнуть, что генотип GG rs909253Ltα контролирует повышенную продукцию Ltα. Поэтому у индивидуумов с данным маркером мы можем ожидать и более выраженные этио патогенетические эффекты Ltα [17]. Следует отметить, что нами впервые установлено важное значение локуса rs909253 Ltα при СД2 среди населения России.

По другим исследуемым генетическим полиморфизмам достоверных различий в частотах аллелей и генотипов не обнаружено (p>0,05).

При анализе возраста манифестации СД2 установлено, что индивидуумы с генотипом AArs767455TNFR1 имеют более ранний возраст манифестации СД2 (х±SD=47,01±0,92) по сравнению с больными с генетическими вариантами AG и GGrs767455TNFR1 (х±SD=48,99±0,72, р=0,01) (табл. 4).

Таблица 4. Медико-биологические и клинические характеристики больных СД2 в зависимости от генотипов локуса rs767455TNFR1, х±SD

Показатели

Генотип по локусу rs767455 TNFR1

р

АА (n=64)

АG и GG (n=175)

Возраст, лет

56,93±0,79

58,53±0,76

0,06

Возраст манифестации, лет

47,01±0,92

48,99±0,72

0,01

Длительность диабета, лет

9,92±0,67

9,60±0,59

0,06

Индекс массы тела, кг/м2

31,71±0,68

33,19±0,49

0,06

Гликированный гемоглобин, %

9,12±0,25

8,65±0,22

0,06

Примечание: х – среднее, SD – стандартное квадратичное отклонение

Полученные данные свидетельствуют о значимом влиянии rs767455TNFR1 на возраст манифестации СД2. Согласно литературным данным [18], рецептор фактора некроза опухолей 1-го типа (TNFR1) опосредует все виды действия факторов некроза опухолей, тем самым участвуя в реализации широкого спектра биологических процессов в организме (митогенные факторы в апоптозе адипоцитов, стимуляция секреции лептина и регуляция функции митохондрий, участие в регуляции обмена углеводов и жиров, индукция инсулинорезистентности в жировой ткани и мышцах, подавление секреции инсулина β-клетками островков поджелудочной железы), имеющих важное значение в этиопатогенезе СД2 [19]. Как свидетельствуют данные литературы, генотип АА rs767455TNFR1 связан с усилением экспрессии рецептора фактора некроза опухолей 1-го типа [20], что может обуславливать ранний возраст манифестации СД2.

Заключение

Таким образом, резюмируя полученные в настоящей работе данные, следует отметить, что впервые продемонстрировано важное значение полиморфных маркеров генов Ltα (rs909253Ltα) и рецептора фактора некроза опухоли 1-го типа (rs 767455 TNFR1) в формировании СД2 на выборке из русских жителей Центрального Черноземья России. Генотип GG rs909253Ltα является фактором риска развития СД2 (OR=2,36), индивидуумы с генотипом AA rs767455TNFR1 имеют более ранний возраст манифестации СД2 по сравнению с больными, имеющими генетические варианты AG и GGrs767455TNFR1 (р=0,01).

Дополнительная информация

Финансирование исследования

Финансирование исследования осуществлялось за счет Стипендии Президента РФ.

Конфликт интересов

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Участие авторов

Чурносов М.И. – концепция и дизайн исследования, написание текста; Белоусова О.Н. – сбор и обработка материала, написание текста; Сиротина С.С. – анализ полученных данных, написание текста.

Список литературы

1. Hemmingsen B, Christensen LL, Wetterslev J, et al. Comparison of metformin and insulin versus insulin alone for type 2 diabetes: systematic review of randomised clinical trials with meta-analyses and trial sequential analyses. BMJ. 2012;344:e1771. doi:10.1136/bmj.e1771

2. Дедов И.И., Шестакова М.В., Викулова О.К. Государственный регистр сахарного диабета Российской Федерации: статус 2014 г. и перспективы развития. // Сахарный диабет. — 2015. — Т. 18. — № 3. — С. 5-23. [Dedov II, Shestakova MV, Vikulova OK. National register of diabetes mellitus in Russian Federation: status on 2014. Diabetes mellitus. 2015;18(3):5-23 (in Russ.)] doi: 10.14341/DM201535-22

3. Дедов И.И., Шестакова М.В., Галстян Г.Р., и др. Алгоритмы специализированной медицинской помощи больным сахарным диабетом. Под редакцией И.И. Дедова, М.В. Шестаковой (7-й выпуск). // Сахарный диабет. – 2015. – Т. 18. – № 1S. – C. 1-112. [Dedov II, Shestakova MV, Galstyan GR, et al. Standards of specialized diabetes care. Edited by Dedov II, Shestakova MV (7-th edition). Diabetes mellitus. 2015;18(1S):1-112. (in Russ.)] doi: 10.14341/DM20151S

4. Бондарь И.А., Шабельникова О.Ю. Генетические основы сахарного диабета 2 типа. // Сахарный диабет. – 2013. – Т. 16 – № 4. – С. 11-16. [Bondar' IA, Shabel'nikova OJ. Genetic framework of type 2 diabetes mellitus. Diabetes mellitus. 2013;16(4):11-16. (in Russ.)] doi: 10.14341/DM2013411-16

5. Dehwah MA, Wang M, Huang QY. CDKALl and type 2 diabetes: a global meta-analysis. Genet Mol Res. 2010;9(2):1109-1120. doi: 10.4238/vol9-2gmr802

6. Grigorescu F, Attaoua R, Ait Mkadem ES, Radian S. Susceptibility genes for insulin resistance and type 2 diabetes. In: Cheta D, editor. Genetics of diabetes. Basel: Karger AG; 2010. p. 131–192.

7. Гумилевский Б.Ю., Гумилевская О.П. Аллельный полиморфизм генов цитокинов при хроническом отторжении ренального трансплантата. // Вестник Волгоградского государственного медицинского университета. – 2010. – Т. 35. – № 3. – С. 62-65. [Gumilevskiy BY, Gumilevskaya OP. Allelic polymorphism of cytokine genes in chronic renal transplant rejection. Vestnik Volgogradskogo gosudarstvennogo medicinskogo universiteta. 2010;35(3):62-65. (in Russ.)]

8. Кетлинский С.А., Симбирцев А.С. Цитокины. – СПб.: Фолиант; 2008. [Ketlinskiy SA., Simbircev AS. Citokiny. Saint-Peterberg: Foliant; 2008. (In Russ.)]

9. Schafer SA, Machicao F, Fritsche A, et al. New type 2 diabetes risk genes provide new insights in insulin secretion mechanisms. Diabetes Res Clin Pract. 2011;93(1):9–24. doi: 10.1016/S0168–8227(11)70008-0

10. Golshani H, Haghani K, Dousti M, Bakhtiyari S. Association of TNF-α 308 G/A Polymorphism With Type 2 Diabetes: A Case-Control Study in the Iranian Kurdish Ethnic Group. Osong Public Health Res Perspect. 2015;6(2):94-9. doi: 10.1016/j.phrp.2015.01.003

11. Dhamodharan U, Viswanathan V, Krishnamoorthy E, et al. Genetic association of IL-6, TNF-α and SDF-1 polymorphisms with serum cytokine levels in diabetic foot ulcer. Gene. 2015;565(1):62-7. doi: 10.1016/j.gene.2015.03.063

12. Sesti LEC, Crispim D, Canani LH, et al. The -308G>a polymorphism of the TNF gene is associated with proliferative diabetic retinopathy in Caucasian Brazilians with type 2 diabetes. Invest Ophthalmol Vis Sci. 2015;56(2):1184-90. doi: 10.1167/iovs.14-15758

13. Temesszentandrasi G, Voros K, Borocz Z, et al. Association of human fetuin-A rs4917 polymorphism with obesity in 2 cohorts. J Investig Med. 2015;63(3):548-53. doi: 10.1097/JIM.0000000000000151

14. Garcia-Elorriaga G, Mendoza-Aguilar M, del Rey-Pineda G, Gonzalez-Bonilla C. Genetic polymorphisms of the tumor necrosis factor and lymphotoxin alpha in type 2 diabetes. Rev Med Inst Mex Seguro Soc. 2013;51(1):42-49.

15. Реброва О.Ю. Статистический анализ медицинских данных. Применение пакета прикладных программ Statistica. – М.: Медиа Сфера; 2006. [Rebrova OY. Statisticheskiy analiz medicinskih dannyh. Primenenie paketa prikladnyh program Statistica. Moscow: Media Sfera; 2006. (in Russ.)]

16. Brian EC. Peripheral receptor targets for analgesia: novel approaches to pain treatment. New Jersey: Wiley & Sons; 2009.

17. Okuse K. Pain signalling pathways: From cytokines to ion channels. The International Journal of Biochemistry & Cell Biology. 2007;39(3):490-496. doi:10.1016/j.biocel.2006.11.016

18. Sanghera DK, Blackett PR. Type 2 Diabetes Genetics: Beyond GWAS. J Diabetes Metab. 2012;03(05):2-17. doi:10.4172/2155-6156.1000198

19. Scott RA, Lagou V, Welch RP. Large-scale association study using the Metabochip array reveals new loci influencing glycemic traits and provides insight into the underlying biological pathways. Nat Genet. 2012;44(9):991–1005. doi: 10.1038/ng.2385

20. Vendrell J, Broch M, Fernandez-Real JM, et al. Tumour necrosis factor receptors (TNFRs) in Type 2 diabetes. Analysis of soluble plasma fractions and genetic variations of TNFR2 gene in a case-control study. Diabet Med. 2005;22(4):387-92. doi: 10.1111/j.1464-5491.2004.01392.x


Об авторах

Михаил Иванович Чурносов

ФГБАОУ ВО «Белгородский государственный национальный исследовательский университет»


Россия

д.м.н., профессор


Конфликт интересов:

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

 


Оксана Николаевна Белоусова

ФГБАОУ ВО «Белгородский государственный национальный исследовательский университет»


Россия

к.м.н.


Конфликт интересов:

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.



Светлана Сергеевна Сиротина

ФГБАОУ ВО «Белгородский государственный национальный исследовательский университет»


Россия

к.б.н.


Конфликт интересов:

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.



Дополнительные файлы

Для цитирования:


Чурносов М.И., Белоусова О.Н., Сиротина С.С. Изучение ассоциаций полиморфных маркеров генов факторов некроза опухоли и их рецепторов rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 с формированием сахарного диабета 2 типа. Сахарный диабет. 2017;20(3):166-171. https://doi.org/10.14341/2072-0351-5845

For citation:


Churnosov M.I., Belousova O.N., Sirotina S.S. Study of the associations between polymorphic markers rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 and the development of type 2 diabetes. Diabetes mellitus. 2017;20(3):166-171. https://doi.org/10.14341/2072-0351-5845

Просмотров: 92


Creative Commons License
Контент доступен под лицензией Creative Commons Attribution 4.0 License.


ISSN 2072-0351 (Print)
ISSN 2072-0378 (Online)